949
Association between polymorphisms in the IGF-I, GHR and STAT5A genes and the interval from calving to conception and milk production in Holstein cows
The aim of this study was to investigate the association of polymorphisms in the insulin-like growth factor 1 (IGF-I), growth hormone receptor (GHR) and signal transducer and activator of transcription 5A (STAT5A) genes with the calving to conception interval (CCI) and milk production of Holstein cows. In this study 308 Holstein cows from a commercial herd in southern Brazil were used. The study evaluated cows between the first and sixth lactation with a CCI no longer than 250 days. The animals were reared in a semi-extensive system being milked twice a day. The CCI and milk production data were obtained from the farm management software. Blood samples were collected for DNA extraction. Genotypes were verified by polymerase chain reaction (PCR) using the following primers: IGF-I (TTAAATAATTGGGTTGGAAGACTGC and ACCTTACCCGTATGAAAGGAATATACGT); GHR (TGCGTGCACAGCAGCTCAACC and AGCAACCCCACTGCTGGGCAT); STAT5A (GAGAAGTTGGCGGAGATTATC and CCGTGTGTCCTCATCACCTG). The amplified fragments of IGF-I, GHR and STAT5A were digested with 3U of SnaBI, AluI and BstEII at 37 ° C for 3 hours, respectively. The resulting fragments were subjected to agarose gel electrophoresis for subsequent UV visualization. Statistical analyzes were performed using the GLM procedure. A value of P<0.05 was considered significant. The average milk production adjusted to 305 days of lactation and CCI were 5,652 ± 1,170L and 117 ± 57.8 days, respectively. There was no association between milk production and CCI with the genotypes identified for each gene. The presence of none, one or two alleles had no linear or quadratic association with the evaluated traits for IGF-I, GHR and STAT5A. There was no interaction between the genotypes of each studied gene for milk production and CCI. The low level of milk production suggests that these animals were not subjected to a major metabolic challenge. The somatotropic axis acts regulating metabolism and the reproductive system, and its balance is a result of the metabolic condition of the animal. Thus, it is likely that the function of the studied genes was not impaired in this low challenge condition, therefore without any major changes in the GH/IGF-I axis or folliculogenesis. Under such conditions, the effect of the polymorphisms studied were not observed, as previously shown in studies using high-producing dairy cows. In conclusion, the GHR AluI, IGF -I SnaBI and BstEII STAT5A polymorphisms are not good molecular markers for selection of dairy cows for milk production and CCI in semi-extensive production systems.
Keywords: genetic selection; molecular markers; reproduction